ctsd

Ensembl ID:
ENSDARG00000057698
ZFIN IDs:
ZDB-GENE-010131-8, ZDB-GENE-010131-8
Description:
cathepsin D [Source:RefSeq peptide;Acc:NP_571785]
Human Orthologue:
CTSD
Human Description:
cathepsin D [Source:HGNC Symbol;Acc:2529]
Mouse Orthologue:
Ctsd
Mouse Description:
cathepsin D Gene [Source:MGI Symbol;Acc:MGI:88562]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36610 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080423 Nonsense 240 398 6 9
ENSDART00000128625 Nonsense 238 396 7 10
Genomic Location (Zv9):
Chromosome 18 (position 15799759)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16151525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACTCAGCCTGGTGGTGAGCTGCTACTGGGAGGAACAGACCCCAAATA[T/G]TACACTGGAGATTTCAACTATGTGGACATCAGCAGACAGGCCTATTGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link