mcm6

Ensembl ID:
ENSDARG00000057683
ZFIN ID:
ZDB-GENE-030909-6
Description:
DNA replication licensing factor MCM6 [Source:RefSeq peptide;Acc:NP_001076318]
Human Orthologue:
MCM6
Human Description:
minichromosome maintenance complex component 6 [Source:HGNC Symbol;Acc:6949]
Mouse Orthologue:
Mcm6
Mouse Description:
minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae) Gene [Source:MGI Sym

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38542 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38542
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013781 Nonsense 32 830 1 17
Genomic Location (Zv9):
Chromosome 6 (position 12880201)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12733423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCAAGGACGAGCTGGCTGAAAAATGTCAGAAATTATTCCAGGCCTTTT[T/A]GGAAGAGTGAGTAAACGCGGTTTATCTCATTGTTCTTCATGATGAAAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link