ENSDARG00000057681

Ensembl ID:
ENSDARG00000057681
Human Orthologues:
ZMYM1, ZMYM4, ZMYM6
Human Descriptions:
zinc finger, MYM-type 1 [Source:HGNC Symbol;Acc:26253]
zinc finger, MYM-type 4 [Source:HGNC Symbol;Acc:13055]
zinc finger, MYM-type 6 [Source:HGNC Symbol;Acc:13050]
Mouse Orthologues:
Zmym1, Zmym4, Zmym6
Mouse Descriptions:
zinc finger, MYM domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915560]
zinc finger, MYM-type 4 Gene [Source:MGI Symbol;Acc:MGI:1915035]
zinc finger, MYM-type 6 Gene [Source:MGI Symbol;Acc:MGI:106505]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17599 Nonsense Available for shipment Available now
sa23021 Nonsense Mutation detected in F1 DNA During 2014
sa7824 Nonsense Mutation detected in F1 DNA During 2014
sa4701 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080401 Nonsense 323 1456 7 28
Genomic Location:
Chromosome 17 (position 14609628)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACCAGCTGTTTTGCTCCACCGTGTGTYTAACGAGTTTCAGTTTACCCT[C/A]GGTTCAGTTTACACCCATCATCGCCCCCAAGAAAACCTGCCACCTCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080401 Nonsense 904 1456 18 28
Genomic Location:
Chromosome 17 (position 14592751)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCACACAAACGGATGCTGCAGTGGGTGCTATTCCACATCGAAGAATGT[T/A]GAAGAACAAAGCTCTTATGTGCAGACCTATTACGGAAGAGCAGGGTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080401 Nonsense 1108 1456 22 28
Genomic Location:
Chromosome 17 (position 14588866)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCACAGCAACGGCTGACCCCGGATCAGCAAAAGAGAACAGACTGGTGT[T/A]GACGCTGAAGAGACGTAAGAGGGGCAGAGATGGCCACCCTCCTAGGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080401 Nonsense 1445 1456 28 28
Genomic Location:
Chromosome 17 (position 14572898)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACACGTATCCTAGCTATACAGGACATTCACCTGGACTCGAAACATCAG[C/T]AAAAATACCTGGACTCGTCAGACGAAGAGAGCTCTTAAKGTGAATCTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k2alk78n