sh2b1

Ensembl ID:
ENSDARG00000057679
ZFIN ID:
ZDB-GENE-070209-188
Description:
SH2B adapter protein 1 [Source:RefSeq peptide;Acc:NP_001103925]
Human Orthologue:
SH2B1
Human Description:
SH2B adaptor protein 1 [Source:HGNC Symbol;Acc:30417]
Mouse Orthologue:
Sh2b1
Mouse Description:
SH2B adaptor protein 1 Gene [Source:MGI Symbol;Acc:MGI:1201407]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13668 Nonsense Available for shipment Available now
sa33116 Nonsense Mutation detected in F1 DNA During 2017
sa17429 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083976 Nonsense 34 906 1 8
ENSDART00000141808 Nonsense 34 906 3 10
ENSDART00000143280 Nonsense 34 109 2 2
Genomic Location (Zv9):
Chromosome 3 (position 14965745)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15211351
KASP Assay ID:
2259-3176.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCCCCTTCCGCCATCCCCTTCTCCAKCGCCCTCTCCTCCGTCTCCAT[C/A]GCTGTTGCCCTTGTCCACCAGACCTCCGCCTTTGCCTCCTCCGACTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083976 Nonsense 336 906 1 8
ENSDART00000141808 Nonsense 336 906 3 10
ENSDART00000143280   None 109 None 2
Genomic Location (Zv9):
Chromosome 3 (position 14966652)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15212258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGGCATCTTGCATTGGCGCAGCTCCTCCAGCGACTCCCCGCAGAACTG[C/A]AGCAACTCCAGCCCTCTTCCCTCCAGCTACAGCTACACTACTGGCCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083976 Nonsense 528 906 1 8
ENSDART00000141808 Nonsense 528 906 3 10
ENSDART00000143280   None 109 None 2
Genomic Location (Zv9):
Chromosome 3 (position 14967226)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15212832
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGTGGACGGGGTACGCGTTGGCAYAAGTGCCGTCTAGTTYTGAAAGAA[C/T]GAGATAAGGATGGAGGGGATGGAGGGTTGGAATATTTCCTGGAGTTTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Body mass index: Six new loci associated with body mass index highlight a neuronal influence on body weight regulation. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Weight: Genome-wide association yields new sequence variants at seven loci that associate with measures of obesity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link