ppapdc1b

Ensembl ID:
ENSDARG00000057672
ZFIN ID:
ZDB-GENE-040704-54
Description:
phosphatidate phosphatase PPAPDC1B [Source:RefSeq peptide;Acc:NP_001002211]
Human Orthologue:
PPAPDC1B
Human Description:
phosphatidic acid phosphatase type 2 domain containing 1B [Source:HGNC Symbol;Acc:25026]
Mouse Orthologue:
Ppapdc1b
Mouse Description:
phosphatidic acid phosphatase type 2 domain containing 1B Gene [Source:MGI Symbol;Acc:MGI:1919160]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21712 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21712
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064603   30 331 1 8
ENSDART00000127784   57 358 1 8
ENSDART00000135341 Essential Splice Site None 240 None 8
Genomic Location (Zv9):
Chromosome 10 (position 20618059)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20579473
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAGCCGACGAGGCGACGGTTTAGACGGAAAAGGAAAGAATCCGAAGG[T/A]CTGTATTCAAGCCCGCGCTGCAGACAATGGACGGAGGATGCGCGATGTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link