epas1b

Ensembl ID:
ENSDARG00000057671
ZFIN ID:
ZDB-GENE-060607-11
Description:
endothelial PAS domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001034895]
Human Orthologue:
EPAS1
Human Description:
endothelial PAS domain protein 1 [Source:HGNC Symbol;Acc:3374]
Mouse Orthologue:
Epas1
Mouse Description:
endothelial PAS domain protein 1 Gene [Source:MGI Symbol;Acc:MGI:109169]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa814 Nonsense Available for shipment Available now
sa35421 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080382 Nonsense 654 834 12 16
ENSDART00000123836 Nonsense 653 833 13 17
Genomic Location (Zv9):
Chromosome 13 (position 7749270)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8053790
KASP Assay ID:
554-0718.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCCAGCAAGGCTGGAATGATGGATCCTTTAGCTGCAAAGCGCTCTTGC[C/T]AAGGCATGCCAGCAAATCGAATGGCACCTTTTATGCAAAGGTAAGTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080382 Essential Splice Site 667 834 12 16
ENSDART00000123836 Essential Splice Site 666 833 13 17
Genomic Location (Zv9):
Chromosome 13 (position 7749229)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8053749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTCTTGCCAAGGCATGCCAGCAAATCGAATGGCACCTTTTATGCAAAG[G/A]TAAGTGTGCATGTTACTTGGTGTTAGTTTTGGTTCATTGTTCAGTTTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link