aldoca

Ensembl ID:
ENSDARG00000057661
ZFIN ID:
ZDB-GENE-050706-128
Description:
Fructose-bisphosphate aldolase C-A [Source:UniProtKB/Swiss-Prot;Acc:Q4KMC8]
Human Orthologue:
ALDOC
Human Description:
aldolase C, fructose-bisphosphate [Source:HGNC Symbol;Acc:418]
Mouse Orthologue:
Aldoc
Mouse Description:
aldolase C, fructose-bisphosphate Gene [Source:MGI Symbol;Acc:MGI:101863]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8894 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080377 Essential Splice Site 180 364 5 9
Genomic Location:
Chromosome 15 (position 15108079)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACAGAAAACGCTAAAGTCCTTGCTCGCTATGCTAGTATTTGTCAGCAG[G/A]TAAAACATCAGWGAAGCTAATGTCATCAAATTGGAATATGTTGAGAATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ghllte5d