aldoca

Ensembl ID:
ENSDARG00000057661
ZFIN ID:
ZDB-GENE-050706-128
Description:
Fructose-bisphosphate aldolase C-A [Source:UniProtKB/Swiss-Prot;Acc:Q4KMC8]
Human Orthologue:
ALDOC
Human Description:
aldolase C, fructose-bisphosphate [Source:HGNC Symbol;Acc:418]
Mouse Orthologue:
Aldoc
Mouse Description:
aldolase C, fructose-bisphosphate Gene [Source:MGI Symbol;Acc:MGI:101863]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35835 Nonsense Mutation detected in F1 DNA During 2018
sa8894 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45532 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080377 Nonsense 139 364 5 9
Genomic Location (Zv9):
Chromosome 15 (position 15108205)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16153168
GRCz11 15 16089190
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTGTCTCCATAGGTCTGGACGGGCTCTCAGAACGCTGTGCTCAGTAT[A/T]AAAAGGATGGAGCTGACTTTGCCAAGTGGCGCTGTGTGATGAAAATCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080377 Essential Splice Site 180 364 5 9
Genomic Location (Zv9):
Chromosome 15 (position 15108079)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16153042
GRCz11 15 16089064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACAGAAAACGCTAAAGTCCTTGCTCGCTATGCTAGTATTTGTCAGCAG[G/A]TAAAACATCAGWGAAGCTAATGTCATCAAATTGGAATATGTTGAGAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080377 Nonsense 358 364 9 9
Genomic Location (Zv9):
Chromosome 15 (position 15099243)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16144206
GRCz11 15 16080228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTACACGGTTTGTGGTGACAGCAGTGGAGCTACTGGTCTTTCCCATTA[T/A]CTTTCCAGCTACGCATATTGAATTTGCCCCTGATTTCCATACTCCAACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link