dhx57

Ensembl ID:
ENSDARG00000057660
ZFIN ID:
ZDB-GENE-030131-4078
Description:
Novel protein similar to vertebrate DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 (DHX57) [Source:Un
Human Orthologue:
DHX57
Human Description:
DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 [Source:HGNC Symbol;Acc:20086]
Mouse Orthologue:
Dhx57
Mouse Description:
DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 Gene [Source:MGI Symbol;Acc:MGI:2147067]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9815 Nonsense Available for shipment Available now
sa30968 Nonsense Mutation detected in F1 DNA During 2017
sa22221 Nonsense Available for shipment Available now
sa17834 Nonsense Available for shipment Available now
sa16244 Essential Splice Site Available for shipment Available now
sa17853 Essential Splice Site Available for shipment Available now
sa35420 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9815
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080351 Nonsense 135 1430 1 22
ENSDART00000143226   None 1034 None 20
ENSDART00000147153   None 25 None 2
Genomic Location (Zv9):
Chromosome 13 (position 7716129)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8020649
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAAACTACAGGTCAAAGAACTTCTTCGGGAACTTCAGAATCAGGAGTA[T/A]CAAACCCCWAAYAGGTGAACTTRTGTTTGCTTCTATAGAAACAGCAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30968
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080351 Nonsense 269 1430 3 22
ENSDART00000143226   None 1034 None 20
ENSDART00000147153   None 25 None 2
Genomic Location (Zv9):
Chromosome 13 (position 7712144)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8016664
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCCCGCAAACATCTGATCCCCCTTCACAGGGGGAATGTGTAGCTTTG[C/T]GACAGGAAGAGGCCTTTGCTTTGACGGCAATCTACGGCGAAAGGTTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080351 Nonsense 270 1430 3 22
ENSDART00000143226   None 1034 None 20
ENSDART00000147153   None 25 None 2
Genomic Location (Zv9):
Chromosome 13 (position 7712141)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8016661
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCGCAAACATCTGATCCCCCTTCACAGGGGGAATGTGTAGCTTTGCGA[C/T]AGGAAGAGGCCTTTGCTTTGACGGCAATCTACGGCGAAAGGTTCTGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17834
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080351 Nonsense 537 1430 4 22
ENSDART00000143226 Nonsense 141 1034 2 20
ENSDART00000147153   None 25 None 2
Genomic Location (Zv9):
Chromosome 13 (position 7711250)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8015770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGATGAAGAGGAATGTATCCCAGTAGAAAACGAGAGCTATGTTAACT[T/A]GAGGAAGAGGATGGTGAAGAAGACTGAAATCAGAACTGAGCAAATGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080351 Essential Splice Site 716 1430 7 22
ENSDART00000143226 Essential Splice Site 320 1034 5 20
ENSDART00000147153   None 25 None 2
Genomic Location (Zv9):
Chromosome 13 (position 7706673)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8011193
KASP Assay ID:
2260-6038.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGTCACACATGTGATCGTGGATGAGGTCCATGAACGAACAGAAGAGAG[G/A]TKTGTGGAAAGCTCAAATGCACATAAATAAACCGTCACATRAAGTGAWTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17853
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080351 Essential Splice Site 716 1430 8 22
ENSDART00000143226 Essential Splice Site 320 1034 6 20
ENSDART00000147153   None 25 None 2
Genomic Location (Zv9):
Chromosome 13 (position 7706595)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8011115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAACCGTCACATRAAGTGAWTCTGACAGTRGCACAATACTTGTCTTGCA[G/A]TGACTTCCTGTTGCTGGTTTTGAAGGATCTGATTGTAAAAAGGACAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080351 Nonsense 1393 1430 22 22
ENSDART00000143226 Nonsense 997 1034 20 20
ENSDART00000147153   None 25 None 2
Genomic Location (Zv9):
Chromosome 13 (position 7684450)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7988970
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTTCAACCTGTTTATGCAGGTAGCTGAGCTGGTGAAAGAGCTGCGAT[G/A]GGAGCTGGATCAGCTTTTAGAAGAGAAGATCAAAAATCCCAGTATGGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link