dnttip2

Ensembl ID:
ENSDARG00000057648
ZFIN ID:
ZDB-GENE-080513-5
Description:
deoxynucleotidyltransferase, terminal, interacting protein 2 [Source:RefSeq peptide;Acc:NP_00113925
Human Orthologue:
DNTTIP2
Human Description:
deoxynucleotidyltransferase, terminal, interacting protein 2 [Source:HGNC Symbol;Acc:24013]
Mouse Orthologue:
Dnttip2
Mouse Description:
deoxynucleotidyltransferase, terminal, interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1923173

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8878 Nonsense Mutation detected in F1 DNA During 2017
sa27156 Nonsense Mutation detected in F1 DNA During 2017
sa15115 Nonsense Available for shipment Available now
sa38678 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050651 Nonsense 148 941 2 7
ENSDART00000146965 Nonsense 165 958 2 7
Genomic Location (Zv9):
Chromosome 8 (position 15797824)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15243168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAATCTTGCTCCTCGGCAGCATCAGCGACCCATTCCCRCACTGCCCCA[C/T]GAAGCCTCAGGAAACGAGTTTTGACTTCAGCTTCCGCAAAAGAYGCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050651 Nonsense 355 941 2 7
ENSDART00000146965 Nonsense 372 958 2 7
Genomic Location (Zv9):
Chromosome 8 (position 15798445)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15243789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGACGAGAAGTAAAGCTAAAGTGATTACTTCTGCCATGTCTGAGGAA[C/T]AAAGTGAAGATGAGCAACTTGTAACTCATCATGAAGGTATTCAAGCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15115
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050651 Nonsense 691 941 2 7
ENSDART00000146965 Nonsense 708 958 2 7
Genomic Location (Zv9):
Chromosome 8 (position 15799453)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15244797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGGCTCATGGTAATGGACTGTTTGTCATAGACACTAGACCTGGGCTA[C/T]GACCTGAAGACCAGTACTATGTGGATGCCAAGCAAACTGAGGAAGAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38678
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050651 Essential Splice Site 905 941 6 7
ENSDART00000146965 Essential Splice Site 922 958 6 7
Genomic Location (Zv9):
Chromosome 8 (position 15802717)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 15248061
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAACGTACCATTGTGGAGGAGCTTCTTGCTGATGCTGAGTTTAGAAG[G/A]TATGTTGGAGAAACTGTGGCTGATTAGCTTTATGTGGAGGAAAATGTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link