adam8b

Ensembl ID:
ENSDARG00000057644
ZFIN ID:
ZDB-GENE-070808-1
Mouse Orthologue:
Adam8
Mouse Description:
a disintegrin and metallopeptidase domain 8 Gene [Source:MGI Symbol;Acc:MGI:107825]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10008 Nonsense Available for shipment Available now
sa7686 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6236 Nonsense Mutation detected in F1 DNA During 2014
sa22036 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10008
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066471 Nonsense 241 819 9 23
Genomic Location:
Chromosome 12 (position 9879416)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTWGATNNNNNGAAACAYACTAAAAACATMAKTCTTTTCTCAGTTGTA[T/A]CGATCTCTTAATATCCGAGWGATGTTGGTGGGTCTTGAGGTCTGGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066471 Essential Splice Site 560 819 15 23
Genomic Location:
Chromosome 12 (position 9861777)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTCACTGTGGAAAAACCAAARATGGCATCAGACCCTGTGCAAGAGAG[T/A]ATGTGATGTTTTATMATTTTCCACTTGAAAATAGCTTATAAAATGGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066471 Nonsense 638 819 17 23
Genomic Location:
Chromosome 12 (position 9859021)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAGTGCCAAGAMTTGAACATTTATGGTWGCATTGAAGRCTGTTCACTG[C/T]AGTGCAATGGTCGAGGGGTGAGATCAAAYCTYCTATTATTATATTTATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22036
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066471 Essential Splice Site 672 819 19 23
Genomic Location:
Chromosome 12 (position 9858748)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTAAATAACCTGTAATGTTTTGACACGTTTTACTCTTCTTTCCAACAA[G/A]CAAAGACCATTGGCATCTCAGTAGCTGTTGCAGTCGCTGTGCTTGTGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/np91v91l