cxcr4a

Ensembl ID:
ENSDARG00000057633
ZFIN ID:
ZDB-GENE-020102-1
Description:
chemokine (C-X-C motif) receptor 4a [Source:RefSeq peptide;Acc:NP_571957]
Human Orthologue:
CXCR4
Human Description:
chemokine (C-X-C motif) receptor 4 [Source:HGNC Symbol;Acc:2561]
Mouse Orthologue:
Cxcr4
Mouse Description:
chemokine (C-X-C motif) receptor 4 Gene [Source:MGI Symbol;Acc:MGI:109563]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1098 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa1098
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080350 Nonsense 284 360 2 2
Genomic Location:
Chromosome 6 (position 12835033)
KASP Assay ID:
554-1000.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGATCCTGCTGGACACGCTGATGATGCTGGAGGTGATTCCCCACAGCTG[C/A]GAGCTGGAGCAGGGGCTGCAGAAATGGATCTTCGTGACGGAGGCGCTCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Multiple sclerosis: Meta-analysis of genome scans and replication identify CD6, IRF8 and TNFRSF1A as new multiple sclerosis susceptibility loci. (View Study)
  • Telomere length: Genome-wide association identifies OBFC1 as a locus involved in human leukocyte telomere biology. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8ih9sdu4