galm

Ensembl ID:: ENSDARG00000057630
ZFIN ID:: ZDB-GENE-040718-66
Description:: aldose 1-epimerase [Source:RefSeq peptide;Acc:NP_001002373]
Human Orthologue:: GALM
Human Description:: galactose mutarotase (aldose 1-epimerase) [Source:HGNC Symbol;Acc:24063]
Mouse Orthologue:: Galm
Mouse Description:: galactose mutarotase Gene [Source:MGI Symbol;Acc:MGI:2442420]

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
sa12154	Essential Splice Site	Available for shipment	Available now

Mutation Details

Allele Name:: sa12154
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: G > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000080339	Essential Splice Site	112	342	2	7

The following transcripts of ENSDARG00000057630 do not overlap with this mutation:

ENSDART00000135747

Genomic Location:: Chromosome 13 (position 7672274)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TAAACAATGGACCCAATGCTCTCCATGGAGGACTGAAGGGCTTTGACAAG[G/A]TAAACAAACAAAGCATGCTATGAAACCATTTTTCWAAATAATGTATAAGA
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

5-HTT brain serotonin transporter levels: A non-synonymous polymorphism in galactose mutarotase (GALM) is associated with serotonin transporter binding potential in the human thalamus: results of a genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for GALM

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: