
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
galm
- Ensembl ID:
- ENSDARG00000057630
- ZFIN ID:
- ZDB-GENE-040718-66
- Description:
- aldose 1-epimerase [Source:RefSeq peptide;Acc:NP_001002373]
- Human Orthologue:
- GALM
- Human Description:
- galactose mutarotase (aldose 1-epimerase) [Source:HGNC Symbol;Acc:24063]
- Mouse Orthologue:
- Galm
- Mouse Description:
- galactose mutarotase Gene [Source:MGI Symbol;Acc:MGI:2442420]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12154 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12154
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000080339 | Essential Splice Site | 112 | 342 | 2 | 7 |
The following transcripts of ENSDARG00000057630 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 7672274)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 7976794 GRCz11 13 8308817 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAAACAATGGACCCAATGCTCTCCATGGAGGACTGAAGGGCTTTGACAAG[G/A]TAAACAAACAAAGCATGCTATGAAACCATTTTTCWAAATAATGTATAAGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- 5-HTT brain serotonin transporter levels: A non-synonymous polymorphism in galactose mutarotase (GALM) is associated with serotonin transporter binding potential in the human thalamus: results of a genome-wide association study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: