galm

Ensembl ID:
ENSDARG00000057630
ZFIN ID:
ZDB-GENE-040718-66
Description:
aldose 1-epimerase [Source:RefSeq peptide;Acc:NP_001002373]
Human Orthologue:
GALM
Human Description:
galactose mutarotase (aldose 1-epimerase) [Source:HGNC Symbol;Acc:24063]
Mouse Orthologue:
Galm
Mouse Description:
galactose mutarotase Gene [Source:MGI Symbol;Acc:MGI:2442420]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12154 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12154
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080339 Essential Splice Site 112 342 2 7

The following transcripts of ENSDARG00000057630 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 7672274)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAACAATGGACCCAATGCTCTCCATGGAGGACTGAAGGGCTTTGACAAG[G/A]TAAACAAACAAAGCATGCTATGAAACCATTTTTCWAAATAATGTATAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c7605xp1