dusp14

Ensembl ID:
ENSDARG00000057625
ZFIN ID:
ZDB-GENE-041010-162
Description:
dual specificity protein phosphatase 14 [Source:RefSeq peptide;Acc:NP_001006060]
Human Orthologue:
DUSP14
Human Description:
dual specificity phosphatase 14 [Source:HGNC Symbol;Acc:17007]
Mouse Orthologue:
Dusp14
Mouse Description:
dual specificity phosphatase 14 Gene [Source:MGI Symbol;Acc:MGI:1927168]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22602 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22602
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080338 Nonsense 4 221 2 2
Genomic Location (Zv9):
Chromosome 15 (position 14895801)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15940764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAGGTTTCTACTTCTCTGTCTCCTGCCTCCGCTCCTCTATGGGTTCC[C/T]GAAGTCAGGGCTTCTTCCACCACCAAGACCACCATCACCAGCATCATAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ovarian cancer: GWAS meta-analysis and replication identifies three new susceptibility loci for ovarian cancer. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link