cops5

Ensembl ID:
ENSDARG00000057624
ZFIN ID:
ZDB-GENE-040426-1686
Description:
COP9 signalosome complex subunit 5 [Source:UniProtKB/Swiss-Prot;Acc:Q6PC30]
Human Orthologue:
COPS5
Human Description:
COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) [Source:HGNC Symbol;Acc:2240]
Mouse Orthologue:
Cops5
Mouse Description:
COP9 (constitutive photomorphogenic) homolog, subunit 5 (Arabidopsis thaliana) Gene [Source:MGI Symb

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8923 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080332 Nonsense 202 334 5 8
Genomic Location:
Chromosome 24 (position 24327802)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTTAAAAATAGGGTTACAAGCCTCCAGATGAGGGTCCTTCTGAATAC[C/T]AGACGATACCTCTTAACAAAATTGAGGATTTTGGAGTGCATTGCAAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/skicf3m0