cops5

Ensembl ID:
ENSDARG00000057624
ZFIN ID:
ZDB-GENE-040426-1686
Description:
COP9 signalosome complex subunit 5 [Source:UniProtKB/Swiss-Prot;Acc:Q6PC30]
Human Orthologue:
COPS5
Human Description:
COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) [Source:HGNC Symbol;Acc:2240]
Mouse Orthologue:
Cops5
Mouse Description:
COP9 (constitutive photomorphogenic) homolog, subunit 5 (Arabidopsis thaliana) Gene [Source:MGI Symb

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44139 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8923 Nonsense Mutation detected in F1 DNA During 2016
sa39450 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa44139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080332 Essential Splice Site 168 334 4 8
Genomic Location:
Chromosome 24 (position 24327616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGACTGAACTCTTTTGCTAATTTCAGTCCTTGTAATTTTTCATCCTC[A/T]GATCGATCCCACAAGGACTATATCCGCAGGGAAGGTCAATCTTGGAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080332 Nonsense 202 334 5 8
Genomic Location:
Chromosome 24 (position 24327802)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTTAAAAATAGGGTTACAAGCCTCCAGATGAGGGTCCTTCTGAATAC[C/T]AGACGATACCTCTTAACAAAATTGAGGATTTTGGAGTGCATTGCAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39450
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080332 Nonsense 263 334 7 8
Genomic Location:
Chromosome 24 (position 24331929)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGTCTGGTCTAATGGTTGTTTCTCCAGAATGCAGACTACACCACCGGA[C/T]AGGTGTTTGACTTGTCTGAGAAGCTGGAGCAGGCGGAAGCGCAGCTGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link