si:dkey-195c14.1

Ensembl ID:
ENSDARG00000057586
ZFIN ID:
ZDB-GENE-030131-9140
Description:
hypothetical protein LOC568041 [Source:RefSeq peptide;Acc:NP_001038615]
Human Orthologue:
SALL3
Human Description:
sal-like 3 (Drosophila) [Source:HGNC Symbol;Acc:10527]
Mouse Orthologue:
Sall3
Mouse Description:
sal-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109295]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43268 Nonsense Mutation detected in F1 DNA During 2017
sa43269 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080294 Nonsense 532 1248 3 5
ENSDART00000100181 Nonsense 531 1247 2 4
Genomic Location (Zv9):
Chromosome 19 (position 22552310)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22483690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATCCCCTATGGGATGTCTTTCCCCCCAGAGAAGGCTGGACCTACTTG[G/A]TTAGACAGCAAACCTGTCCTTCCAACAGTGCCGTCTTCGGTTGGTCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080294 Essential Splice Site 1117 1248 4 5
ENSDART00000100181 Essential Splice Site 1116 1247 3 4
Genomic Location (Zv9):
Chromosome 19 (position 22554994)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 22486374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCTGCTCTGTCTGTGGTCGAGCATTCACAACCAAGGGTAATCTTAAGG[T/C]ACGTAATTATTATTGATTCTGTCATTGTCAGGTGTGCGCAAATAAAAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Rheumatoid arthritis: Genome-wide association study of rheumatoid arthritis in the Spanish population: KLF12 as a risk locus for rheumatoid arthritis susceptibility. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link