si:ch211-191d7.6

Ensembl ID:
ENSDARG00000057583
ZFIN IDs:
ZDB-GENE-040724-79, ZDB-GENE-040724-79, ZDB-GENE-081104-156
Description:
Novel protein similar to vertebrate HLA-B associated transcript 2 (BAT2) [Source:UniProtKB/TrEMBL;Ac
Human Orthologue:
BAT2L2
Human Description:
HLA-B associated transcript 2-like 2 [Source:HGNC Symbol;Acc:24903]
Mouse Orthologue:
Bat2l2
Mouse Description:
HLA-B associated transcript 2-like 2 Gene [Source:MGI Symbol;Acc:MGI:1913754]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43402 Nonsense Mutation detected in F1 DNA During 2017
sa36996 Nonsense Mutation detected in F1 DNA During 2017
sa11325 Essential Splice Site Available for shipment Available now
sa23657 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080289 Nonsense 799 2814 13 32
ENSDART00000133936   None 377 None 8
ENSDART00000135212 Nonsense 339 1630 4 11
Genomic Location (Zv9):
Chromosome 20 (position 15058561)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 15153197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCTCCTAAGCAACTGGTACGACGAGAGCCCACGGACAACAGCAGCTCT[G/T]GATCAGACACTTTTGATCATCTGACACGACCAATCAGAGAACATGGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080289 Nonsense 1076 2814 14 32
ENSDART00000133936   None 377 None 8
ENSDART00000135212 Nonsense 616 1630 5 11
Genomic Location (Zv9):
Chromosome 20 (position 15057645)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 15152281
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAAGAGAGAAAGAAGAGCAACATGAACGAGGAGATCGAACCAAAAAA[G/T]AAGGATTTGCACCCAAAGGTGCTTCGTCAGCTGCTATAGTGGCATGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11325
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080289 Essential Splice Site 2006 2814 19 32
ENSDART00000133936   None 377 None 8
ENSDART00000135212 Essential Splice Site 1546 1630 10 11
Genomic Location (Zv9):
Chromosome 20 (position 15053550)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 15148186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCAGAGGCAAAAACAGCCCCGTGCTGGACCTGTCAAGCCTCAGAAGG[T/C]AGTGTTTCATGRAGAGGGAAGTGAATCATGAAGAGTAACAGATTTATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080289 Nonsense 2555 2814 28 32
ENSDART00000133936   None 377 None 8
ENSDART00000135212   None 1630 None 11
Genomic Location (Zv9):
Chromosome 20 (position 15038781)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 15133689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTCTTCCGCCGACTCCTCCTCAAGCGCCACCTCCCAGCCTCAACCGG[C/T]AGCCACCCAACAATCCGCCCTACCGTGGCCTCATTGGCCAAAACACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link