LOC561692

Ensembl ID:
ENSDARG00000057582
Human Orthologue:
KLHL34
Human Description:
kelch-like 34 (Drosophila) [Source:HGNC Symbol;Acc:26634]
Mouse Orthologue:
Klhl34
Mouse Description:
kelch-like 34 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2685234]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31101 Nonsense Mutation detected in F1 DNA During 2017
sa44150 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080284 Nonsense 265 578 1 1
Genomic Location (Zv9):
Chromosome 24 (position 26155839)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25357955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTCAGGGTCCCCTACAACCTCTGCTACAAAGTGTCCACACCAGCCTC[A/T]GAGCCACAAACAGCAAGATTGTTTTGGTGGGAGGAGGATCAGAAGCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44150
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080284 Nonsense 355 578 1 1
Genomic Location (Zv9):
Chromosome 24 (position 26155569)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 25358225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGATGGAGGTCACTGACCAGGTGTGGCGCTATGATCCACGGTTTGAG[C/T]AGTGGGAGGAGATGGAACCACTCTTGCAGAAGAGGGCACAGTTTGCCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link