mbtps2

Ensembl ID:
ENSDARG00000057577
ZFIN ID:
ZDB-GENE-030131-6598
Description:
membrane-bound transcription factor site-2 protease [Source:RefSeq peptide;Acc:NP_001020632]
Human Orthologue:
MBTPS2
Human Description:
membrane-bound transcription factor peptidase, site 2 [Source:HGNC Symbol;Acc:15455]
Mouse Orthologue:
Mbtps2
Mouse Description:
membrane-bound transcription factor peptidase, site 2 Gene [Source:MGI Symbol;Acc:MGI:2444506]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4295 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4295
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105820 Nonsense 37 494 2 11
Genomic Location:
Chromosome 24 (position 26199881)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTTCAYCTTCAGTCATCCAGTTCGGTAAAGAACCGCTATGAATCATG[G/A]TTATCCTCGAATGGATTCACACTATCTCCCTTCCATATCAAGTGGCACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7ema5piy