pgam2

Ensembl ID:
ENSDARG00000057571
ZFIN ID:
ZDB-GENE-040116-6
Description:
phosphoglycerate mutase 2 [Source:RefSeq peptide;Acc:NP_957318]
Human Orthologue:
PGAM2
Human Description:
phosphoglycerate mutase 2 (muscle) [Source:HGNC Symbol;Acc:8889]
Mouse Orthologue:
Pgam2
Mouse Description:
phosphoglycerate mutase 2 Gene [Source:MGI Symbol;Acc:MGI:1933118]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23900 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23900
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080269 Nonsense 26 255 1 3
Genomic Location (Zv9):
Chromosome 21 (position 17821574)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18969826
KASP Assay ID:
2261-5460.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACGCCATGGCGAGAGCTCTTGGAACCAAGAAAACCGTTTCTGCGGCTG[G/A]TTTGATGCAGATCTCAGTGAGAAAGGCCTGGAGGAGGCGAAACGCGGCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link