si:ch211-222n4.10

Ensembl ID:
ENSDARG00000057568
ZFIN ID:
ZDB-GENE-091117-1
Mouse Orthologue:
Nefl
Mouse Description:
neurofilament, light polypeptide Gene [Source:MGI Symbol;Acc:MGI:97313]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12368 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080263 Nonsense 274 475 2 6
ENSDART00000128381   359 551 2 5
ENSDART00000136196   359 616 2 4
Genomic Location (Zv9):
Chromosome 21 (position 17824429)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 18972681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCCATCCTTCTCCRCAGGATACAATCAGTGAYCTTGAGGAWGAACTT[C/T]GAGCCACTAAGGGCGAAATGGCCAGATAYCTTAAAGAGTATCAGGATCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link