polr3c

Ensembl ID:
ENSDARG00000057562
ZFIN ID:
ZDB-GENE-040426-992
Description:
DNA-directed RNA polymerase III subunit RPC3 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUX1]
Human Orthologue:
POLR3C
Human Description:
polymerase (RNA) III (DNA directed) polypeptide C (62kD) [Source:HGNC Symbol;Acc:30076]
Mouse Orthologue:
Polr3c
Mouse Description:
polymerase (RNA) III (DNA directed) polypeptide C Gene [Source:MGI Symbol;Acc:MGI:1921664]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28613 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059967 Essential Splice Site 463 539 14 15
Genomic Location (Zv9):
Chromosome 16 (position 16043031)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14387923
KASP Assay ID:
554-6818.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAGTTTTTGATTTTGTCATTAATGTTTTTTTTTATTATTATTTTGACA[G/A]GCGGCTTTTGGAGAAATCTCAGCGGATTGAGGCCATCCTAGCATCCTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link