mdm4

Ensembl ID:
ENSDARG00000057513
ZFIN ID:
ZDB-GENE-030131-6872
Description:
Protein Mdm4 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUW7]
Human Orthologue:
MDM4
Human Description:
Mdm4 p53 binding protein homolog (mouse) [Source:HGNC Symbol;Acc:6974]
Mouse Orthologue:
Mdm4
Mouse Description:
transformed mouse 3T3 cell double minute 4 Gene [Source:MGI Symbol;Acc:MGI:107934]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1700 Nonsense Available for shipment Available now
sa6207 Nonsense Mutation detected in F1 DNA During 2014
sa10933 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1700
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080201 Nonsense 61 496 4 11
Genomic Location:
Chromosome 11 (position 23846273)
KASP Assay ID:
554-1646.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTTTTGAACAGGTCATGCATTATCTGGGTCAGTACATCATGATGAAG[C/T]AGCTGTATGACAAACAGAGGCAGCACATCGTCCACTGTCACGATGACCCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa6207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080201 Nonsense 323 496 11 11
Genomic Location:
Chromosome 11 (position 23827478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGATGCATGGCAGTGTTCAGAGTGCCGCAAGTTTAAYACCCCTCTTCAG[C/T]GATACTGCATGCGCTGCTGGGCTCTGCGGAAAGACTGGTACAAGGATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10933
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080201 Nonsense 434 496 11 11
Genomic Location:
Chromosome 11 (position 23827143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACATCAGAGGGGGATAGTCAGGACACTCTGGACATGGAGACCGAAWA[T/G]CAACCTGAGGCCTTGTTGGAACCCTGCAAGCTGTGTCGTGTGCGGCCGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r4ehjulv