si:ch211-32j10

Ensembl ID:
ENSDARG00000057508
ZFIN ID:
ZDB-GENE-100922-283
Human Orthologue:
NBEAL2
Human Description:
neurobeachin-like 2 [Source:HGNC Symbol;Acc:31928]
Mouse Orthologue:
Nbeal2
Mouse Description:
neurobeachin-like 2 Gene [Source:MGI Symbol;Acc:MGI:2448554]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31003 Nonsense Mutation detected in F1 DNA During 2018
sa42692 Nonsense Mutation detected in F1 DNA During 2018
sa18226 Nonsense Available for shipment Available now
sa15725 Nonsense Available for shipment Available now
sa13722 Nonsense Available for shipment Available now
sa15336 Nonsense Available for shipment Available now
sa36080 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22794 Nonsense Available for shipment Available now
sa44844 Nonsense Mutation detected in F1 DNA During 2018
sa22793 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031188 Nonsense 42 2801 2 55
ENSDART00000135050   None 2647 None 51

The following transcripts of ENSDARG00000057508 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 18529960)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16572900
GRCz11 16 16480877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTTGGAGGCATTCGTGGCGTCTTTTGAGAAGGTCATTGATGTGCACT[C/A]GATTGAGCCTCGCCGGTGAGTCAGTTTCATGCTGACCTATCAAAATGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031188 Nonsense 222 2801 7 55
ENSDART00000135050 Nonsense 162 2647 5 51

The following transcripts of ENSDARG00000057508 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 18520139)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16563079
GRCz11 16 16471056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGGTGGTGAGGCTGGTGCATCTACAGGGAGCTGTAATCAGTGGATGC[A/T]AGGTAAATTAGACCCTTAGGCCCTGTTTACACTGACATGTGTGAACGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031188 Nonsense 254 2801 8 55
ENSDART00000135050 Nonsense 194 2647 6 51

The following transcripts of ENSDARG00000057508 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 18519916)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16562856
GRCz11 16 16470833
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGTCTGTGTTGCGCTCCTGGTGCCTYTGTCCTGCCTCATCCCCACAG[C/T]AGCCCAGGRACCCTCAGCTGCTCAGGATGGCCCYTCGCTGTCTGACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15725
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031188 Nonsense 1075 2801 21 55
ENSDART00000135050 Nonsense 984 2647 18 51

The following transcripts of ENSDARG00000057508 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 18476529)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16519343
GRCz11 16 16427320
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCTGCTCTTTGACTTCCGCATCTGGAGCCGCAGCCACTTCGCTGTCTG[T/A]CTGGGTAATAAAAAATACTTTGACAAMCAKAAAACATCATTRTAGCGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031188 Nonsense 1291 2801 26 55
ENSDART00000135050 Nonsense 1200 2647 23 51

The following transcripts of ENSDARG00000057508 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 18467126)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16509940
GRCz11 16 16417917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACTTRTTGGCAGTGGTGTACTTATCCCATCGTGCCGATCTCAGTGCT[C/T]GACTAGAAATTGTTCGTAAGGTAAGTGATGGATTATCAAAGGATTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15336
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031188 Nonsense 1308 2801 27 55
ENSDART00000135050 Nonsense 1217 2647 24 51

The following transcripts of ENSDARG00000057508 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 18466492)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16509306
GRCz11 16 16417283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTKTTTTNTCCCTGCAGCTCTTCTGCTTGATCCACTCCAACGAAGAGTA[T/G]GTGAARCAGCTGGCTCATCAATCAGGCTGGCAGGATGTTCTCACCAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031188 Essential Splice Site 1689 2801 31 55
ENSDART00000135050 Essential Splice Site 1535 2647 27 51

The following transcripts of ENSDARG00000057508 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 18451897)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16494711
GRCz11 16 16402688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAACCATGAGAATAAATTTCAACAACTGCTTTTTTTTTTTTTCTCTC[A/T]GGTGTGTGAGATGGCATGTCTAAAGCTTCACAGTTTGCTGCAGACAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031188 Nonsense 1802 2801 32 55
ENSDART00000135050 Nonsense 1648 2647 28 51

The following transcripts of ENSDARG00000057508 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 18447331)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16490145
GRCz11 16 16398122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTTTTTCCTAATGTATGCCTGCAGGTGGAGCCCACAATGCAGCAGTA[T/A]GAGCTGGACACTTTTGGGAAGAGCCACGACTTGATGTCCAACTTCTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031188 Nonsense 2202 2801 41 55
ENSDART00000135050 Nonsense 2048 2647 37 51

The following transcripts of ENSDARG00000057508 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 18433163)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16475977
GRCz11 16 16383954
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTATGAGAGTTTTGAAGACCCAACAGGCACTATTGATAAGTTCCACTA[T/G]GGCACACACTACTCTAATGCTGCTGGCGTCATGCACTACATGATCCGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031188 Nonsense 2349 2801 44 55
ENSDART00000135050 Nonsense 2195 2647 40 51

The following transcripts of ENSDARG00000057508 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 18428643)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16471457
GRCz11 16 16379434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAACGGGGACCTGAAGCAGTGGAGGCTCTTAATGTCTTCTACTACTG[C/A]ACTTATGAGGGTAAGAGACCTCTTATGAGTTCACATTAGCTGTTTCCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link