habp2

Ensembl ID:
ENSDARG00000057498
ZFIN IDs:
ZDB-GENE-030131-4721, ZDB-GENE-030131-4721
Description:
hyaluronan-binding protein 2 [Source:RefSeq peptide;Acc:NP_001103843]
Human Orthologue:
HABP2
Human Description:
hyaluronan binding protein 2 [Source:HGNC Symbol;Acc:4798]
Mouse Orthologue:
Habp2
Mouse Description:
hyaluronic acid binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1196378]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10853 Essential Splice Site Available for shipment Available now
sa31885 Missense, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10853
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122379 Essential Splice Site 47 558 None 13
ENSDART00000123154 Essential Splice Site None 496 None 14
Genomic Location (Zv9):
Chromosome 12 (position 33400566)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31598563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCATGTTTATATTGCATTTCTGTCTGACTGAAAGTGTGGCGACTGTTTC[A/G]GGGTCTTTTGGAAGACTTCATTGGSWTTGTCGATGGTAAGAAGTCTRAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122379 Missense 71 558 3 13
ENSDART00000123154 Nonsense 9 496 3 14
Genomic Location (Zv9):
Chromosome 12 (position 33401062)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31599059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCTGACAGAAATATATGACTATGTTGTTAGTGACACGGAGGAAATA[T/A]CTTCAGCTGAAATTAACGAGACGATTGACTGGCTTTTTTCCTTCTTTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link