ptcd3

Ensembl ID:
ENSDARG00000057494
ZFIN ID:
ZDB-GENE-030131-6849
Description:
Pentatricopeptide repeat-containing protein 3, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q32LU7
Human Orthologue:
PTCD3
Human Description:
Pentatricopeptide repeat domain 3 [Source:HGNC Symbol;Acc:24717]
Mouse Orthologue:
Ptcd3
Mouse Description:
pentatricopeptide repeat domain 3 Gene [Source:MGI Symbol;Acc:MGI:1917206]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42381 Nonsense Mutation detected in F1 DNA During 2017
sa22457 Essential Splice Site Available for shipment Available now
sa14622 Nonsense Available for shipment Available now
sa17910 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080138 Nonsense 44 667 2 24

The following transcripts of ENSDARG00000057494 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 20080403)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15845138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTATTTATAGAAGTTTTGCAGCGTATCAACAACCTGATGTTTCTTCA[C/T]AAGGTTAGACGATTAGTTTCGGTCTCTTTGAAATAAAAGTTACAGCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22457
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080138 Essential Splice Site 282 667 11 24

The following transcripts of ENSDARG00000057494 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 20071686)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15836421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCCAAGCATTTAGCACCTACACTGACCTGCTCAACAACCGACTTAAAG[G/T]TGAATATGCAAATACATTTACAGTTTATAAGATTTTATGGATCAGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080138 Nonsense 544 667 21 24

The following transcripts of ENSDARG00000057494 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 20059848)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15824583
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAATGCACATTTGTGTTTCTGTCCAGGTSCAGGAGTCATTTGCTGATTG[T/A]GCGCTGGACATAATGAAAATGTATGACACAAATGAGAGAGGCAAGGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080138 Nonsense 586 667 21 24

The following transcripts of ENSDARG00000057494 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 20059723)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15824458
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGACGTCACCACTATTCTACTAGCCGCTAACAGGAGACAAGAAGCCT[G/A]GTAAGCTCCTATATGGACAGCTGTAATKTCATCAAGATCTACAGTAATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link