rnf157

Ensembl ID:
ENSDARG00000057481
Human Orthologue:
RNF157
Human Description:
ring finger protein 157 [Source:HGNC Symbol;Acc:29402]
Mouse Orthologue:
Rnf157
Mouse Description:
ring finger protein 157 Gene [Source:MGI Symbol;Acc:MGI:2442484]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35332 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22140 Essential Splice Site Available for shipment Available now
sa35333 Nonsense Mutation detected in F1 DNA During 2017
sa2645 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa35332
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080166 Essential Splice Site 30 655 1 19
Genomic Location (Zv9):
Chromosome 12 (position 33416688)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31614685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTCGATATACCGTCTAATTCTGTTTACAGATACCCACCCAAATCTGG[T/A]GAGAATATATATTGTTATATATTTTATATTCTGTCATTATATTATATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22140
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080166 Essential Splice Site 69 655 2 19
Genomic Location (Zv9):
Chromosome 12 (position 33422989)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31620986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGGTGAAAACACAGACCTCAACTTCCTAGGCAACAGACCAGTAGTGG[T/C]AAGATTGCAGTTCAATTCCTGTTATTAGATCCAGACATACATGCTCTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080166 Nonsense 280 655 10 19
Genomic Location (Zv9):
Chromosome 12 (position 33431392)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31629389
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTTGCTGAAGATGAGATTAGTGACAACAGCGCTGAATGTGTGGTGTG[T/A]TTGTCGGACGTGCGGGACACACTGATCCTGCCCTGCAGACACCTGTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2645
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080166 Nonsense 546 655 15 19
Genomic Location (Zv9):
Chromosome 12 (position 33441110)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31639107
KASP Assay ID:
554-2943.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCACAGACACTCTGTCCTCAATGTCTGGATCCTACATGGCTGGAGCC[G/T]AGGGGGAGGAGGCTGCTGAGACCCCAGCCGAGAGCAGAGCACCTTCACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link