lrrc28

Ensembl ID:
ENSDARG00000057477
ZFIN ID:
ZDB-GENE-061128-1
Human Orthologue:
LRRC28
Human Description:
leucine rich repeat containing 28 [Source:HGNC Symbol;Acc:28355]
Mouse Orthologue:
Lrrc28
Mouse Description:
leucine rich repeat containing 28 Gene [Source:MGI Symbol;Acc:MGI:1915689]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17332 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080160 Essential Splice Site 82 366 3 9
Genomic Location:
Chromosome 7 (position 16392672)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTTCTTAGCTACCTGCACTCAAACAACATTGCAATAATTCCTCAAG[G/A]TAATGRTGTTGTTTTACTAAATAAAGCAGTCTTCCGGTGTCAGATGCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5v7ncwan