ENSDARG00000057473

Ensembl ID:
ENSDARG00000057473

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28094 Nonsense Mutation detected in F1 DNA During 2016
sa38933 Essential Splice Site Mutation detected in F1 DNA During 2016
sa791 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101899 Nonsense 40 305 1 4
Genomic Location:
Chromosome 13 (position 20002372)
KASP Assay ID:
2260-6274.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGTCTTTGCTGGAGATGGAGGAGATGGCGGTGCTACGAGCACTGGAC[A/T]AGCTCATTCAGACAAACCATGCCATCCTCTGCGACATCGAGGTCCAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101899 Essential Splice Site 125 305 3 4
Genomic Location:
Chromosome 13 (position 20005388)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGCCCTAGCTGGGTCAGTTGGCTGGTTGGAGCCCTAGCTGGGTCAGTT[G/C]GCTGGTTGGAGCCCTAGCTGGGTCAGTTGGCTGGTTGGAGCCCTAGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101899 Nonsense 231 305 4 4
Genomic Location:
Chromosome 13 (position 20006511)
KASP Assay ID:
554-0696.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGGCCGCCATGCTGAATCTTGGTGTCTGGAGTATTTTGATGGAGACTW[C/A]AATGCATGGCATGGAGGTATATCTCATCCCTTGCCAATCTCTAAGTGTTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link