ENSDARG00000057473

Ensembl ID:
ENSDARG00000057473

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa791 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa791
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101899 Nonsense 231 305 4 4
Genomic Location:
Chromosome 13 (position 20006511)
KASP Assay ID:
554-0696.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGGCCGCCATGCTGAATCTTGGTGTCTGGAGTATTTTGATGGAGACTW[C/A]AATGCATGGCATGGAGGTATATCTCATCCCTTGCCAATCTCTAAGTGTTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3zlqmmc6