kcnc2

Ensembl ID:
ENSDARG00000057468
ZFIN IDs:
ZDB-GENE-070410-118, ZDB-GENE-070410-118
Description:
voltage-gated potassium channel Kv3.2 [Source:RefSeq peptide;Acc:NP_001082998]
Human Orthologue:
KCNC2
Human Description:
potassium voltage-gated channel, Shaw-related subfamily, member 2 [Source:HGNC Symbol;Acc:6234]
Mouse Orthologue:
Kcnc2
Mouse Description:
potassium voltage gated channel, Shaw-related subfamily, member 2 Gene [Source:MGI Symbol;Acc:MGI:96

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18302 Nonsense Available for shipment Available now
sa20177 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18302
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103356 None None 375 None 3
ENSDART00000110178 Nonsense 122 589 1 4
Genomic Location:
Chromosome 4 (position 2057415)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGCATCGATGAGACGGACGTGGAGCCGTGCTGCTGGATGMCYTACCGA[C/T]AGCACCGCGATGCCGAGGAGGCGCTGGACGTGTTTGRGATGAACGTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103356 Nonsense 101 375 1 3
ENSDART00000110178 Nonsense 296 589 2 4
Genomic Location:
Chromosome 4 (position 2024194)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCATATTGCCGTTTTACCTGGAAGTGGGACTGAGTGGACTTTCCTCC[A/T]AAGCTGCTAAAGACGTGCTGGGTTTTCTGCGAGTGGTGCGTTTCGTTCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/inq1ywui