gfpt1

Ensembl ID:
ENSDARG00000057465
ZFIN ID:
ZDB-GENE-070423-1
Description:
glucosamine--fructose-6-phosphate aminotransferase [Source:RefSeq peptide;Acc:NP_001030153]
Human Orthologue:
GFPT1
Human Description:
glutamine--fructose-6-phosphate transaminase 1 [Source:HGNC Symbol;Acc:4241]
Mouse Orthologue:
Gfpt1
Mouse Description:
glutamine fructose-6-phosphate transaminase 1 Gene [Source:MGI Symbol;Acc:MGI:95698]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34504 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080135 Nonsense 388 426 11 12
Genomic Location (Zv9):
Chromosome 8 (position 52762127)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50021639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATCAACAACTCCAAACGCACCATTAAAGTGCCTCACTGTGTGGACTG[T/A]CTGCAGGGCATCTTGAGCGTCATCCCTCTACAGCTGCTGTCCTTCCACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link