immt

Ensembl ID:
ENSDARG00000057454
ZFIN ID:
ZDB-GENE-030131-5417
Description:
mitochondrial inner membrane protein [Source:RefSeq peptide;Acc:NP_001001401]
Human Orthologue:
IMMT
Human Description:
inner membrane protein, mitochondrial [Source:HGNC Symbol;Acc:6047]
Mouse Orthologue:
Immt
Mouse Description:
inner membrane protein, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1923864]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22456 Essential Splice Site Available for shipment Available now
sa42380 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38989 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35678 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22456
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080120 Essential Splice Site 188 757 5 14
Genomic Location (Zv9):
Chromosome 14 (position 20032529)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15797264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCGCACCAGGTACAAGTGATGAAAGCCCATCTGGCCACTCGGCGGCAG[G/A]TCAGCATTGGATCATTCACAGTCTTCTGCTTATGACAACTGATCCACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080120 Essential Splice Site 273 757 8 14
Genomic Location (Zv9):
Chromosome 14 (position 20040740)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15805475
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGCGTGCGTGTGTGCATGTGTGTGTGCATGTGTGTGCCCA[G/T]ACTCCTCCAGATGAGAAGTCCACTCAGGCACTGAATGAGGCTCTGAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080120 Essential Splice Site 394 757 10 14
Genomic Location (Zv9):
Chromosome 14 (position 20044730)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15809465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTTGCCAACATCACACCTGAGATCCAGGCCAACTGGAAAGGACTATG[T/A]AAGATATCACACTCTTTACATGGATTCAAGTTCTCTACATTTTATATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35678
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080120 Nonsense 561 757 14 14
Genomic Location (Zv9):
Chromosome 14 (position 20052194)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15816929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTCACATATCAAATATTTGTTTTGTCTTCAAGGTCATGTGATTGCT[G/T]AGGAAGAGGCTCGTAAAGCTCACCAGCTGTGGCTTTCGGTTGAAGCTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link