si:ch73-119j17.3

Ensembl ID:
ENSDARG00000057439
ZFIN ID:
ZDB-GENE-100922-277
Human Orthologue:
PHF1
Human Description:
PHD finger protein 1 [Source:HGNC Symbol;Acc:8919]
Mouse Orthologue:
Phf1
Mouse Description:
PHD finger protein 1 Gene [Source:MGI Symbol;Acc:MGI:98647]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9170 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa15490 Nonsense Available for shipment Available now
sa42809 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa22939 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080059 Splice Site, Nonsense 21 519 1 14
ENSDART00000134471 Splice Site, Nonsense 26 326 2 11
Genomic Location (Zv9):
Chromosome 16 (position 48489728)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45458949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTTTGGCCAGGTGGAGCGATGGACTTTTATATCTCGGCAATGTYAAA[C/T]GAGTAAGTTTCTCCAAGTTTGTTCGGAGRAGGGAGCCGGTGGARAGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080059 Nonsense 272 519 9 14
ENSDART00000134471 Nonsense 277 326 10 11
Genomic Location (Zv9):
Chromosome 16 (position 48504181)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45473402
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTCAGACACGCCRAGGCAAGACCGTTGCCAAAACCTGCTCAACGCTT[T/A]AAACTCCCACAAAGACAGGTGAGACAYGGATTACGCTCGGAAAAAGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42809
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080059 Splice Site, Nonsense 368 519 11 14
ENSDART00000134471   None 326 None 11
Genomic Location (Zv9):
Chromosome 16 (position 48505888)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45475109
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAACAGAAATCAAACATCACTGTCAAGAGTTTGTACAAGCACACAGA[C/T]AGTTGAGCTTGTTTTTCTTGTAGTCTTTTAATTATTTTTTGCAAGATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080059 Nonsense 484 519 14 14
ENSDART00000134471   None 326 None 11
Genomic Location (Zv9):
Chromosome 16 (position 48507703)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45476924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCGGGACGTGCCTCCCTTCCACAGCCCCGTGGGCATGGCTGCACCAT[C/A]GAGCATGGGCTGGGCAGGAGGAGATGCTGTCCGAATCCTTGCCCGACGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link