rnf103

Ensembl ID:
ENSDARG00000057438
ZFIN ID:
ZDB-GENE-040912-171
Description:
RING finger protein 103 [Source:RefSeq peptide;Acc:NP_001004600]
Human Orthologues:
RNF103, RP11-269K22.1
Human Descriptions:
ring finger protein 103 [Source:HGNC Symbol;Acc:12859]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B8ZZK9]
Mouse Orthologue:
Rnf103
Mouse Description:
ring finger protein 103 Gene [Source:MGI Symbol;Acc:MGI:109483]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22455 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22455
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080114 Nonsense 571 656 4 4
Genomic Location (Zv9):
Chromosome 14 (position 20020578)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15785313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACATGATCATTACGGGTGTTCAGCTGCAACCAAGTCAGAAGAGAGTTG[G/A]TCTGGTGGAGAGGAACAGGACACTGATTGGTCTCAGTGGCCTTGTGGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link