c1qtnf3

Ensembl ID:
ENSDARG00000057435
ZFIN ID:
ZDB-GENE-050522-484
Description:
alpha-methylacyl-CoA racemase [Source:RefSeq peptide;Acc:NP_001018462]
Human Orthologue:
AMACR
Human Description:
alpha-methylacyl-CoA racemase [Source:HGNC Symbol;Acc:451]
Mouse Orthologue:
Amacr
Mouse Description:
alpha-methylacyl-CoA racemase Gene [Source:MGI Symbol;Acc:MGI:1098273]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18251 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18251
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080110 Nonsense 104 382 3 6
Genomic Location (Zv9):
Chromosome 21 (position 18250341)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19385830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGGATTAGGTCCTGAAGACTTAATAAAAGAGAACCCCCGCCTGATCTA[C/A]GCACGTCTCACTGGTTAYGGTCAGAGCGGATCCTWTGCMAAGGCTGCCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link