mxd3

Ensembl ID:
ENSDARG00000057432
ZFIN ID:
ZDB-GENE-040426-1588
Description:
Max dimerization protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q7SX95]
Human Orthologue:
MXD3
Human Description:
MAX dimerization protein 3 [Source:HGNC Symbol;Acc:14008]
Mouse Orthologue:
Mxd3
Mouse Description:
Max dimerization protein 3 Gene [Source:MGI Symbol;Acc:MGI:104987]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31982 Nonsense Available for shipment Available now
sa31981 Essential Splice Site Available for shipment Available now
sa42379 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31982
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080103 Nonsense 18 200 1 6
Genomic Location (Zv9):
Chromosome 14 (position 20012188)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15776923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGTAAATACGTGCAACATCCAAGTGCTTCTGCAGGCAGCTGAATATT[T/A]GGAGCGGAGGGAAAGAGGTAACTAAAGTGCCGTTTCTTTCTCATGTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080103 Essential Splice Site 59 200 2 6
Genomic Location (Zv9):
Chromosome 14 (position 20011405)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15776140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGAAAGAAGCAGAAATCAAAGAGCCATTCATCACCAGGGAACAGCAG[G/A]TGAGTGTGAGGTGCACAGACGAACGCGCCCCCGTTCTTTTGTCCCTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080103 Nonsense 76 200 4 6
Genomic Location (Zv9):
Chromosome 14 (position 20008444)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15773179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACATGTGATATTGTGTGTGTGGTTGTAGGAGAGCTCAGTTAAGACATTG[T/A]TTGGAGCAGCTGAAGCAGCAGGTTCCTCTGTCCTCAGATTCATCAAGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link