rxfp3

Ensembl ID:
ENSDARG00000057410
ZFIN ID:
ZDB-GENE-080723-67
Description:
relaxin/insulin-like family peptide receptor 3 [Source:RefSeq peptide;Acc:NP_001122260]
Human Orthologue:
RXFP3
Human Description:
relaxin/insulin-like family peptide receptor 3 [Source:HGNC Symbol;Acc:24883]
Mouse Orthologue:
Rxfp3
Mouse Description:
relaxin family peptide receptor 3 Gene [Source:MGI Symbol;Acc:MGI:2441827]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5958 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080076 Nonsense 305 408 1 1
Genomic Location (Zv9):
Chromosome 21 (position 18315991)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19451480
KASP Assay ID:
554-3853.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAACAGCGTGGGGTATCTTGATAAAACTCAACGTGGTACACTTCAGTTA[C/A]GAGTATTATACCACACAGGTGTATATTTTCCCTGTCACGGTGTGTTTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link