LOC793240

Ensembl ID:
ENSDARG00000057399
Human Orthologue:
PVRL3
Human Description:
poliovirus receptor-related 3 [Source:HGNC Symbol;Acc:17664]
Mouse Orthologue:
Pvrl3
Mouse Description:
poliovirus receptor-related 3 Gene [Source:MGI Symbol;Acc:MGI:1930171]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10384 Nonsense Available for shipment Available now
sa15247 Nonsense Available for shipment Available now
sa21188 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10384
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080062 Nonsense 431 550 6 6
Genomic Location (Zv9):
Chromosome 8 (position 5756956)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15027858
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTCGGACATTCAGAGGGGACTATTATACAAAACAATACATAGGCCCRT[C/A]GGACATGCAGAAGGAGTCACAACTGGATGTTCTTGAGYCGCAMGAGCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15247
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080062 Nonsense 524 550 6 6
Genomic Location (Zv9):
Chromosome 8 (position 5756678)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15028136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAACCCCAGTGGGCCGCCGCTGCACAACGGCTCCCCCTACCTGCGGGAC[G/T]AGTGCTTCGATAATGCCACAGACAATGATTAYGTGYCGCACRTCGACGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080062 Nonsense 549 550 6 6
Genomic Location (Zv9):
Chromosome 8 (position 5756601)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15028213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTACGTGTCGCACATCGACGGGTCCGTGATCTCGCGCAGGGAATGGTA[T/A]GTTTGAGAAGGACTTTTATTAAACAGCCGAACAGTAATTTAAGTAAAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link