si:ch211-130m23.3

Ensembl ID:
ENSDARG00000057395
ZFIN ID:
ZDB-GENE-060531-14
Description:
single-stranded DNA-binding protein 2 [Source:RefSeq peptide;Acc:NP_001103848]
Human Orthologue:
SSBP2
Human Description:
single-stranded DNA binding protein 2 [Source:HGNC Symbol;Acc:15831]
Mouse Orthologue:
Ssbp2
Mouse Description:
single-stranded DNA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1914220]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33698 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20519 Essential Splice Site Available for shipment Available now
sa33697 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080033 Essential Splice Site 18 350 1 17
Genomic Location (Zv9):
Chromosome 5 (position 47884955)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45673695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCCAAAGGCAAGAGCAGCGTGCCGTCGGACAGTCAAGCCCGAGAAAAG[T/A]AAGTTATTGATCAGTAGATGGAGGAGATCGCATCTGCAGCCGCGCACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080033 Essential Splice Site 203 350 10 17
Genomic Location (Zv9):
Chromosome 5 (position 47821946)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45610686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTATTGCTACTTCTGTATAAAATAATATATCTGTGTACTATATGTAA[A/G]GGGGTCCTGCAGGAGGAAGACCATGGCCAAATCCTCCAAATAACAACTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080033 Essential Splice Site 342 350 17 17
Genomic Location (Zv9):
Chromosome 5 (position 47818154)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45606894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTAAATACAGCTGCAGATATCATTCAATGCCATCTTCTGTCTTACA[G/A]TATTCTCCTAACATGACAATGAGTGTGTGAGAGGACAGCACAGGAGCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link