sfxn3

Ensembl ID:
ENSDARG00000057374
ZFIN ID:
ZDB-GENE-070112-2092
Description:
sideroflexin-3 [Source:RefSeq peptide;Acc:NP_001074133]
Human Orthologue:
SFXN3
Human Description:
sideroflexin 3 [Source:HGNC Symbol;Acc:16087]
Mouse Orthologue:
Sfxn3
Mouse Description:
sideroflexin 3 Gene [Source:MGI Symbol;Acc:MGI:2137679]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38932 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057867 Nonsense 233 322 7 11
Genomic Location (Zv9):
Chromosome 13 (position 18728948)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18548983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAATCAACTAATGCTGCTCAGCAAGCCATCGTACAGGTGGTGGTGTCT[C/T]GAATTGGCATGGCAGTGCCAGCCATGGGTAAGCTTTAGTGAGCTATTACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link