LOC100332844

Ensembl ID:
ENSDARG00000057353
Human Orthologue:
EHBP1L1
Human Description:
EH domain binding protein 1-like 1 [Source:HGNC Symbol;Acc:30682]
Mouse Orthologue:
Ehbp1l1
Mouse Description:
EH domain binding protein 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:3612340]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20889 Nonsense Mutation detected in F1 DNA During 2014
sa20890 Nonsense Mutation detected in F1 DNA During 2014
sa15934 Essential Splice Site Available for shipment Available now
sa15513 Nonsense Available for shipment Available now
sa20891 Nonsense Mutation detected in F1 DNA During 2014
sa16586 Nonsense Available for shipment Available now
sa12016 Nonsense Available for shipment Available now
sa8264 Nonsense Mutation detected in F1 DNA During 2014
sa1940 Splice Site, Nonsense Available for shipment Available now
sa1555 Nonsense Available for shipment Available now
sa11356 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 587 4318 11 33
Genomic Location:
Chromosome 7 (position 19277355)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCTCTCCTGTCTACTCCTCATCCCGCTGTTTCTGATGCTCCTCTGTG[T/A]CTCACTTCTGATGTTGGTCCTGTGGTCATCACTCCTGTTTTCTCCGATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 1330 4318 16 33
Genomic Location:
Chromosome 7 (position 19291573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTCATGCCTGAAACACAAATAACATCTGGTACTTTATCAGCATGTCCA[C/T]AAACCTCTAAAACACCAGGCTTTCCCTCTTTAGTCCCAAGCAAGCTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15934
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Essential Splice Site 1667 4318 16 33
Genomic Location:
Chromosome 7 (position 19292586)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGYTTTTTGGGAAGAAGTGAGGAAGGACAAAAGGGAATTCTGGAAAGGGG[G/A]TAAGTTCAGAATTACCCACGTGTTTGTTAYACCAACAAAGAAAATRTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 1965 4318 18 33
Genomic Location:
Chromosome 7 (position 19295428)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGRTGATTCCATMCCTGCGGATGAGACCKTCATATCTGRATTACCKTCA[C/T]AAAWCCCAGATTCAGTCCCTACATCCCAAASAGAMCCAAATATGTTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 3379 4318 22 33
Genomic Location:
Chromosome 7 (position 19302449)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCAACCAAATACAGATAACATTTATATTCAAACAGAAGACAATCAGTA[T/A]ACAAGTCTGCCAATCCCAGAGCCACGTGTAAAGAAACGTCTTAGTGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 3458 4318 22 33
Genomic Location:
Chromosome 7 (position 19302684)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTRATTCTTTTCCAGATGASTTTTCATCCMCACCAKACACTCCTCCAWCT[A/T]AAGCAGATCCAGATTGCACTGSAACCCAACCAGAAGACAATCAGRATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12016
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 3659 4318 22 33
Genomic Location:
Chromosome 7 (position 19303287)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATTTCAAGAATGACAGGGACTCTAATGAAAACCTTCCAAGCTTGACT[C/T]AAGTTTCTCCCTCRATAGTCTCARAAGAAGCCAAGCTTCCTCTCTTGGAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 3783 4318 22 33
Genomic Location:
Chromosome 7 (position 19303660)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGAAGAAAAGATGACTGCTGTATATTTTGGAGATGATGCTGTTGATT[T/A]GAGCACTGTAGATGACACAGGGGTTGTCTTAGATGTTTCTAGGTAAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1940
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Splice Site, Nonsense 3798 4318 23 33
Genomic Location:
Chromosome 7 (position 19304121)
KASP Assay ID:
554-1928.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCAGTACTGTTAAAYGTATTTCTTTTGTTGTGATTTATTTTATTTAGA[C/T]AATCTGCAGCAGAAGATTCCCCAAGCGCTCCTGTGCCAATGCCTCGCGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Nonsense 3836 4318 23 33
Genomic Location:
Chromosome 7 (position 19304237)
KASP Assay ID:
554-1498.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCTTTTCCAGAAGACTCCATTACCAGTTCCTCATCAGACAACCAATG[T/A]AAGGTTTCAGAAAAGTCTCTTAATGAGCCAACAGTGCCTGCKCGTAATAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa11356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089211 Splice Site, Nonsense 4141 4318 27 33
Genomic Location:
Chromosome 7 (position 19307635)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWGCATCAGTCCAAGCAGAAACTGAAGCAACCAAAGGAAGCYCAGAATCA[C/T]GTAAGATTTAACATTTTAATGTCNNTTTTTGCTTCAACACATTTRATTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/13jl6cjh