pdgfrb2

Ensembl ID:
ENSDARG00000057345
ZFIN ID:
ZDB-GENE-030805-2
Description:
beta-type platelet-derived growth factor receptor [Source:RefSeq peptide;Acc:NP_001177862]
Human Orthologue:
PDGFRB
Human Description:
platelet-derived growth factor receptor, beta polypeptide [Source:HGNC Symbol;Acc:8804]
Mouse Orthologue:
Pdgfrb
Mouse Description:
platelet derived growth factor receptor, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:97531]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22413 Essential Splice Site Available for shipment Available now
sa16389 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22413
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028255 Essential Splice Site 26 887 1 18
Genomic Location (Zv9):
Chromosome 14 (position 3463573)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150207.1 85536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTCGACCATCAGCCGCATCCACTTCCTATTCACTGCTATCACAACAG[G/A]TAATAGACTAAACAAAGCCTAAAATCAGCATCCCACTGCAGTATGATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16389
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028255 Nonsense 553 887 11 18
Genomic Location (Zv9):
Chromosome 14 (position 3483366)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150207.1 105329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATCTACACTTTGTTTTGCCTGYAGAAGCCRCGGTATGAAATCAGGTG[G/A]AAGGTRATTGAATCAGTCAGTTTGGATGGACACGAGTACATCTACGTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link