cth1

Ensembl ID:
ENSDARG00000057328
ZFIN ID:
ZDB-GENE-990806-20
Description:
cth1 [Source:RefSeq peptide;Acc:NP_571014]
Human Orthologue:
ZFP36
Human Description:
zinc finger protein 36, C3H type, homolog (mouse) [Source:HGNC Symbol;Acc:12862]
Mouse Orthologues:
Zfp36, Zfp36l3
Mouse Descriptions:
zinc finger protein 36 Gene [Source:MGI Symbol;Acc:MGI:99180]
zinc finger protein 36, C3H type-like 3 Gene [Source:MGI Symbol;Acc:MGI:3525151]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20888 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9814 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079966 Essential Splice Site 40 256 1 3
ENSDART00000101601 Essential Splice Site 3 319 1 2
Genomic Location:
Chromosome 7 (position 19194080)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGTTTCTTCAGTTTTGTGCAGCAGTCTGAAAACGCAGTAATGTTTGAG[G/A]TAAGTTTGATCTTTCATTGTGTTTTAATTTGAACTACGTTAAGTTTTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079966 Nonsense 115 256 2 3
ENSDART00000101601 Nonsense 78 319 2 2
Genomic Location:
Chromosome 7 (position 19195848)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACYGAACTGTGCAGCCGTTATGCKGAGACGGGTACCTGCAAGTACGCC[G/T]AACGCTGCCAGTTTGCCCAYGGCCTCCATGATCTCCATGTGCCCTCCCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tt4dmhnw