si:ch211-215h6.2

Ensembl ID:
ENSDARG00000057323
ZFIN ID:
ZDB-GENE-041111-260
Description:
Im:7149356 protein [Source:UniProtKB/TrEMBL;Acc:Q58EH2]
Human Orthologue:
E2F8
Human Description:
E2F transcription factor 8 [Source:HGNC Symbol;Acc:24727]
Mouse Orthologue:
E2f8
Mouse Description:
E2F transcription factor 8 Gene [Source:MGI Symbol;Acc:MGI:1922038]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25357 Nonsense Mutation detected in F1 DNA During 2017
sa34023 Nonsense Mutation detected in F1 DNA During 2017
sa34022 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40850 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079953 Nonsense 50 932 3 14
ENSDART00000128488 Nonsense 35 917 2 13
ENSDART00000131726   None 236 None 4
ENSDART00000134548 Nonsense 45 239 2 4
ENSDART00000144118 Nonsense 35 203 3 5
Genomic Location (Zv9):
Chromosome 7 (position 17371942)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16344731
KASP Assay ID:
554-7461.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAACATGATGTGTTTTCAATATAACAGGGGCATGTTTTTGTGGAGCCA[C/T]AAACGCCACTAAAAAACTCAAATAAAGCTTCAACATCTGAAGCTGCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079953 Nonsense 232 932 5 14
ENSDART00000128488 Nonsense 217 917 4 13
ENSDART00000131726   None 236 None 4
ENSDART00000134548 Nonsense 227 239 4 4
ENSDART00000144118   None 203 None 5
Genomic Location (Zv9):
Chromosome 7 (position 17368309)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16341098
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGACGCTTGCTGTGCTGAAACGGGCCGGAAAAGAGAACCGCTATGAA[C/T]AGCTTATGCAGCAGATCCGACAAAGGAGTCAAGAGCGAGAAGAGAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079953 Essential Splice Site 382 932 7 14
ENSDART00000128488 Essential Splice Site 367 917 6 13
ENSDART00000131726   None 236 None 4
ENSDART00000134548   None 239 None 4
ENSDART00000144118   None 203 None 5
Genomic Location (Zv9):
Chromosome 7 (position 17364732)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16337521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCCTGCTTTCAAATGGACTGGGCCAGAAGACATACCATCTCCAAAGG[G/A]TAAGCATTAAAGCATGTTTCACATGAAATCTGACCTGTTCATAATCCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079953 Nonsense 706 932 11 14
ENSDART00000128488 Nonsense 691 917 10 13
ENSDART00000131726 Nonsense 63 236 1 4
ENSDART00000134548   None 239 None 4
ENSDART00000144118   None 203 None 5
Genomic Location (Zv9):
Chromosome 7 (position 17357239)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 16330028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGAAGAGCCAGACCTCAGACAATGAGGCAGGACTGACCCCTGTAAGA[C/T]AACCACATTCACAGCCCCAGAAGCTCAGCGCTCCCTTTCAGGACATGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link