nexn

Ensembl ID:
ENSDARG00000057317
ZFIN IDs:
ZDB-GENE-041114-92, ZDB-GENE-041114-92, ZDB-GENE-041114-92, ZDB-GENE-041114-92, ZDB-GENE-041114-92
Description:
nexilin [Source:RefSeq peptide;Acc:NP_001077324]
Human Orthologues:
AC026150.5, AC091304.2, AC100756.2, AC135983.4, AC138749.1, GOLGA6L1, GOLGA6L2, GOLGA6L6, NEXN
Human Descriptions:
golgin A6 family-like 1 [Source:HGNC Symbol;Acc:37444]
golgin A6 family-like 2 [Source:HGNC Symbol;Acc:26695]
golgin A6 family-like 6 [Source:HGNC Symbol;Acc:37225]
nexilin (F actin binding protein) [Source:HGNC Symbol;Acc:29557]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9IYW0]
Mouse Orthologue:
Nexn
Mouse Description:
nexilin Gene [Source:MGI Symbol;Acc:MGI:1916060]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21252 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21252
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079936 Nonsense 423 861 7 14
ENSDART00000100558   None 176 8 15
ENSDART00000100562 Nonsense 423 845 7 13
ENSDART00000122471 Nonsense 423 612 8 12
ENSDART00000128203 Nonsense 423 598 8 13
Genomic Location (Zv9):
Chromosome 8 (position 19043470)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18488358
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAATTCAGACCAGGAAAACTTCGACTCAGTTTTGAAGAGCTGGAAAGA[C/T]AGAGGCTGGAAGACGAACATAAGCGGGTTGAGGAAGAGAGGAAAAGACGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link