ENSDARG00000057305

Ensembl ID:
ENSDARG00000057305
Human Orthologue:
PRKRIR
Human Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr
Mouse Orthologue:
Prkrir
Mouse Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11461 Nonsense Available for shipment Available now
sa9497 Nonsense Available for shipment Available now
sa12705 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11461
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110294 Nonsense 4 643 1 2
Genomic Location:
Chromosome 20 (position 12912105)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCTTCATTTTCAGGAAAGGTGGTACAAAGAATATCCATGGCTTCATTA[T/G]AGCCCCACAGTTAAGGGAATTCTCTGTTTTCACTGTGTGAAAATATATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9497
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110294 Nonsense 436 643 2 2
Genomic Location:
Chromosome 20 (position 12913420)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARTCAACTCTCCAGTTCAAAAGGAACRAAGAAAGATTTCAGGAGATTTTT[A/T]AAAAAGCARTGAAAATGGTGGACTCTCTTGGCATTGAACCCATTCAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110294 Nonsense 436 643 2 2
Genomic Location:
Chromosome 20 (position 12913420)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARTCAACTCTCCAGTTCAAAAGGAACRAAGAAAGATTTCAGGAGATTTTT[A/T]AAAAAGCARTGAAAATGGTGGACTCTCTTGGCATTGAACCCATTCAGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nsxj73fl