galnt7

Ensembl ID:
ENSDARG00000057303
ZFIN ID:
ZDB-GENE-050522-284
Description:
N-acetylgalactosaminyltransferase 7 [Source:RefSeq peptide;Acc:NP_001018477]
Human Orthologue:
GALNT7
Human Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) [Sour
Mouse Orthologue:
Galnt7
Mouse Description:
UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase 7 Gene [Source:MGI

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39648 Nonsense Mutation detected in F1 DNA During 2017
sa30802 Essential Splice Site Mutation detected in F1 DNA During 2017
sa1202 Essential Splice Site F2 line generated During 2017
sa6596 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079928 Nonsense 19 652 1 12
ENSDART00000114903 Nonsense 19 652 1 13
ENSDART00000135666   None 211 None 5

The following transcripts of ENSDARG00000057303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 38552479)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37423935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAAAGGTTGGATTCATCCTTCGAAGTTTGCTGGTCATCGGCACATTTT[T/A]GGGGCTGGTTTTGCTTTGGTCTTCTTTGACACCGAAGGCTGGAGACGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30802
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079928 Essential Splice Site 42 652 None 12
ENSDART00000114903 Essential Splice Site 42 652 None 13
ENSDART00000135666   None 211 None 5

The following transcripts of ENSDARG00000057303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 38552551)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37424007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTGACACCGAAGGCTGGAGACGATAACCCGTTTGCTGGTGTAATGG[T/A]AAGCTAGGATGGTCGTTAGTTACCTTGACACGTTATTGTTTTCGTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1202
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079928   None 652 None 12
ENSDART00000114903 Essential Splice Site 378 652 6 13
ENSDART00000135666 Essential Splice Site 132 211 3 5

The following transcripts of ENSDARG00000057303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 38565964)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37437420
KASP Assay ID:
554-1111.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGTAGCAAGGAGAAGCAGAAGAGACTAACTAGAACTGAGCCCTATCGG[T/A]AATTTAAAGCCATAATCCTGAGCTGATTAGGGCTGACCACAACACGCATA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa6596
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079928 Nonsense 392 652 7 12
ENSDART00000114903 Nonsense 392 652 7 13
ENSDART00000135666 Nonsense 146 211 4 5

The following transcripts of ENSDARG00000057303 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 38569156)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37440612
KASP Assay ID:
554-4885.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTCAGGTCTCCTGCCATGGCTGGAKGGCTGTTTGCAATTGAGAGA[G/T]AATTCTTCTTTGAGYTGGGTCTTTATGATCCAGGCCTTCARATCTGGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link