cbln1

Ensembl ID:
ENSDARG00000057296
ZFIN ID:
ZDB-GENE-040718-226
Description:
cerebellin 1 precursor [Source:RefSeq peptide;Acc:NP_001002520]
Human Orthologue:
CBLN1
Human Description:
cerebellin 1 precursor [Source:HGNC Symbol;Acc:1543]
Mouse Orthologue:
Cbln1
Mouse Description:
cerebellin 1 precursor protein Gene [Source:MGI Symbol;Acc:MGI:88281]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13627 Nonsense Available for shipment Available now
sa10043 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079926 Nonsense 76 158 1 4
ENSDART00000145342 Nonsense 77 190 1 3
Genomic Location:
Chromosome 18 (position 17763906)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTTCCGTGGTGAGAAACACGAACCACGAGCCGTCGGAGATGAGCAAT[C/T]GAACTATGGTGATCTACTTCGATCAGGTACAGTTTCAGTATGGAAAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10043
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079926 None None 158 None 4
ENSDART00000145342 Nonsense 179 190 3 3
Genomic Location:
Chromosome 18 (position 17768297)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCGCCTACCTCAAGCTGGAGCGAGGCAACCTGATGGGCGGCTGGAAATA[T/G]TCCACCTTCTCCGGCTTCCTGGTCTTCCCCCTGTAGAGGAGGGGTGTACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b3y5gu1z