olfcg6

Ensembl ID:
ENSDARG00000057293
ZFIN ID:
ZDB-GENE-081029-9
Description:
odorant receptor [Source:RefSeq peptide;Acc:NP_001153313]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35665 Nonsense Mutation detected in F1 DNA During 2017
sa38985 Nonsense Mutation detected in F1 DNA During 2017
sa44805 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104801 Nonsense 200 837 3 6
Genomic Location (Zv9):
Chromosome 14 (position 17713374)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32825639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTCAGGACTATTTCTAGTGATTACCACATGAGTAGAGCACTTGTCTA[T/A]ATAGTTAAGCATTTAGACTGGTCTTGGGTTGGTGCTGTGAACAGTGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104801 Nonsense 272 837 3 6
Genomic Location (Zv9):
Chromosome 14 (position 17713589)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32825854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTGACACTATAAACAAAGGCACTGCTAAAGTAATTGTAGCATTTGTTT[C/A]ATTTGTGGAGATGGGCTTACTTATTGATCAATTAAGTATTCAGAACATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44805
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104801 Nonsense 653 837 6 6
Genomic Location (Zv9):
Chromosome 14 (position 17715089)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTCACACAGCATTTGGCATCACTTTTGTCCTGTGTATCTCATGTGTTT[T/A]GGGTAAAACAATAGTAGTGTTAATGGCCTTTAAGGCTACACTCCCAGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link