olfcg6

Ensembl ID:
ENSDARG00000057293
ZFIN ID:
ZDB-GENE-081029-9
Description:
odorant receptor [Source:RefSeq peptide;Acc:NP_001153313]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35665 Nonsense Mutation detected in F1 DNA During 2017
sa38985 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104801 Nonsense 200 837 3 6
Genomic Location (Zv9):
Chromosome 14 (position 17713374)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32825639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTCAGGACTATTTCTAGTGATTACCACATGAGTAGAGCACTTGTCTA[T/A]ATAGTTAAGCATTTAGACTGGTCTTGGGTTGGTGCTGTGAACAGTGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104801 Nonsense 272 837 3 6
Genomic Location (Zv9):
Chromosome 14 (position 17713589)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32825854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTGACACTATAAACAAAGGCACTGCTAAAGTAATTGTAGCATTTGTTT[C/A]ATTTGTGGAGATGGGCTTACTTATTGATCAATTAAGTATTCAGAACATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link