iqca1

Ensembl ID:
ENSDARG00000057276
ZFIN ID:
ZDB-GENE-050208-768
Description:
IQ motif containing with AAA domain 1 [Source:RefSeq peptide;Acc:NP_001092201]
Human Orthologue:
IQCA1
Human Description:
IQ motif containing with AAA domain 1 [Source:HGNC Symbol;Acc:26195]
Mouse Orthologue:
4931409K22Rik
Mouse Description:
RIKEN cDNA 4931409K22 gene Gene [Source:MGI Symbol;Acc:MGI:3045319]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20676 Nonsense Available for shipment Available now
sa40659 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104681 Nonsense 75 471 2 11
ENSDART00000127133 Nonsense 75 630 2 15
ENSDART00000128939 Nonsense 75 406 2 8
Genomic Location (Zv9):
Chromosome 6 (position 15668843)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15642075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGTTTACGATCAGATTGTTCACCCCCAGAAGAGACGTGTCGTGCAC[C/T]AGGTTCTTGACGGAGTGATGGGACGATTGGTAGAGCTGAAGAATGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104681 Nonsense 145 471 3 11
ENSDART00000127133 Nonsense 145 630 3 15
ENSDART00000128939 Nonsense 145 406 3 8
Genomic Location (Zv9):
Chromosome 6 (position 15669314)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 15642546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGAGGGCGTTGAAGGAGAGGGAGAAGATGCTGGCCCATGTTTTGGCT[A/T]AAGAAGGACGTCCAGAACACAAATCTGTGAATGTATGTTCATAAAAAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link