si:dkey-7c22.1

Ensembl ID:
ENSDARG00000057255
ZFIN ID:
ZDB-GENE-060810-98
Human Orthologue:
KIAA0090
Human Description:
KIAA0090 [Source:HGNC Symbol;Acc:28957]
Mouse Orthologue:
C230096C10Rik
Mouse Description:
RIKEN cDNA C230096C10 gene Gene [Source:MGI Symbol;Acc:MGI:2443696]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31087 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa43962 Nonsense Mutation detected in F1 DNA During 2017
sa43963 Nonsense Mutation detected in F1 DNA During 2017
sa29912 Nonsense Mutation detected in F1 DNA During 2017
sa43964 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37686 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104268 Splice Site, Nonsense 31 964 2 22

The following transcripts of ENSDARG00000057255 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21555731)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21335038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCATCCTGATCTGTCATCATGTGTTAACATCACTCTCATTTCTTCCAG[G/A]AGGCAACAGTACATCGGCAAGGTGCGTTTTGCCTTGTTTGATACTCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104268 Nonsense 386 964 11 22

The following transcripts of ENSDARG00000057255 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21561236)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21340543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAAATTGGTTTATCGGTTCTTTAGTTGTATGTCCACGCCTTCCTAAAA[A/T]AAGATGACTCGGTGGGCTACAGAGTCATGGTACAGACGGAAGACCTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104268 Nonsense 408 964 11 22

The following transcripts of ENSDARG00000057255 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21561302)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21340609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTACAGAGTCATGGTACAGACGGAAGACCTTACACTCACATTTCTGCAG[C/T]AGCCTGGTATGAACTACATTATGCCACAATTCCTTTTATTTTTATTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104268 Nonsense 465 964 13 22

The following transcripts of ENSDARG00000057255 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21563632)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21342939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGGACTGTTACCCATGGTTCTCAAGCGTCTCTCTTCCCAGTTCATCT[T/A]GCTACAGGCCTGGATGGCTCATCTCTGGAAACTTTTCTATGATGCCCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104268 Essential Splice Site 566 964 None 22

The following transcripts of ENSDARG00000057255 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21566628)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21345935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTCAATACTGAATCTTATTTAAGAATGGACTGTATCTATTTATTTTT[A/T]GGATACAGGGCTTGGAAGCCTGTATGTCTTCAATCCCATCTTCGGCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104268 Nonsense 650 964 16 22

The following transcripts of ENSDARG00000057255 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21566962)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21346269
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGAGACTGCATCTTCCATATTTTTCTACCTAGTGGACTCCAACCAG[G/T]GAAAGCTGTCGGGTTTTCGTCTGCGCACGGTTTGCATTCACCATCAGAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link